primer → ReceivesAction → directed at the 16s rrna forward: cggcaggcctaacacatgcaagtcg
Typicality: 0.250
Saliency: 0.000
Facets 0
No facets.
Open triples 1
primer → be directed at → the 16s rrna forward: cggcaggcctaacacatgcaagtcg 3
Sentiment analysis
negative neutral positive
0.072 0.900 0.028
Other statistics
Raw frequency 3
Normalized frequency 0.000
Modifier score 0.500
Perplexity 34.341