---

primer → ReceivesAction → listed in additional file	0.83
primer → ReceivesAction → listed in table	0.83
primer → ReceivesAction → designed	0.80
primer → ReceivesAction → shown in table	0.76
primer → HasProperty → dry	0.76
primer → HasProperty → mandatory	0.76
primer → CapableOf → use for pcr	0.75
primer → ReceivesAction → listed in table s1	0.74
primer → ReceivesAction → obtained	0.71
primer → ReceivesAction → described in table	0.69
primer → ReceivesAction → listed in table s2	0.69
primer → CapableOf → use for amplification	0.69
primer → ReceivesAction → purchased	0.67
primer → HasProperty → complementary	0.67
primer → HasProperty → essential	0.67
primer → CapableOf → use for sequencing	0.66
primer → ReceivesAction → described	0.65
primer → ReceivesAction → synthesized	0.65
primer → HasProperty → specific	0.65
primer → CapableOf → use for qrt-pcr	0.64
primer → ReceivesAction → listed in supplemental material	0.64
primer → HasProperty → compatible	0.63
primer → ReceivesAction → listed in supplementary table	0.63
primer → ReceivesAction → listed in table s3	0.63
primer → ReceivesAction → selected	0.63
primer → UsedFor → pcr amplification	0.63
primer → CapableOf → use for qpcr	0.63
primer → CapableOf → use for rt-pcr	0.62
primer → ReceivesAction → developed	0.62
primer → CapableOf → use for cloning	0.61
primer → HasProperty → white	0.61
primer → ReceivesAction → listed in supplementary table s1	0.61
primer → ReceivesAction → removed	0.60
primer → HasProperty → great	0.60
primer → ReceivesAction → listed in table s7	0.60
dna polymerase → HasPrerequisite → primer	0.59
primer → ReceivesAction → shown in table s1	0.59
primer → ReceivesAction → described in additional file	0.58
primer → HasProperty → appropriate	0.57
primer → ReceivesAction → synthesized by integrated dna technologies	0.57
primer → ReceivesAction → shown	0.57
primer → ReceivesAction → checked	0.57
primer → ReceivesAction → added	0.56
primer → HasProperty → good	0.56
primer → ReceivesAction → shown in figure	0.56
primer → ReceivesAction → published	0.55
primer → HasA → silicone	0.55
primer → ReceivesAction → recommended	0.55
primer → CapableOf → use for real-time pcr	0.55
primer → ReceivesAction → ordered	0.55
primer → CapableOf → use for plasmid construction	0.55
primer → CapableOf → provide maximum adhesion	0.55
primer → ReceivesAction → synthesized by sangon biotech	0.54
primer → ReceivesAction → synthesized by shanghai	0.53
primer → ReceivesAction → created equal	0.52
primer → ReceivesAction → shown in fig	0.52
primer → UsedFor → genotyping	0.52
primer → ReceivesAction → synthesized by invitrogen	0.52
primer → HasProperty → lightweight	0.52
primer → CapableOf → fill void	0.52
primer → HasProperty → thick	0.52
primer → CapableOf → lock in loose wood fibers	0.51
gesso → IsA → primer	0.50
primer → ReceivesAction → tested	0.49
primer → HasA → mismatch	0.49
primer → ReceivesAction → synthesized by eurogentec	0.49
primer → ReceivesAction → tested for specificity	0.49
primer → ReceivesAction → designed to match in a pcr experiment	0.49
primer → HasProperty → resistant	0.48
primer → ReceivesAction → adapted	0.47
primer → ReceivesAction → applied after moisturizer	0.47
primer → ReceivesAction → fired	0.46
primer → ReceivesAction → synthesized by idt	0.46
primer → HasProperty → tacky	0.45
primer → CapableOf → form binding layer	0.44
primer → CapableOf → create barrier	0.44
primer → HasProperty → clear	0.44
primer → ReceivesAction → listed in s10 table	0.44
primer → ReceivesAction → listed in appendix	0.44
primer → ReceivesAction → manufactured	0.44
primer → ReceivesAction → tinted	0.43
primer → ReceivesAction → used in combination	0.42
primer → HasProperty → identical	0.42
primer → HasProperty → necessary	0.42
primer → ReceivesAction → diluted	0.41
primer → ReceivesAction → desalted	0.41
primer → CapableOf → produce single amplicon	0.41
primer → CapableOf → face right way	0.41
primer → ReceivesAction → purified by high-performance liquid chromatography	0.41
primer → ReceivesAction → described in table s1	0.41
primer → ReceivesAction → used as control	0.41
primer → ReceivesAction → utilized	0.40
primer → ReceivesAction → annealed	0.40
primer → ReceivesAction → used to amplify dna	0.40
primer → ReceivesAction → updated	0.39
primer → HasProperty → porous	0.39
primer → ReceivesAction → extended	0.39
primer → ReceivesAction → sanded	0.39
primer → HasA → wax	0.38
primer → ReceivesAction → indicated	0.38
primer → ReceivesAction → designed for use	0.38
primer → HasProperty → unique	0.38
primer → HasProperty → useful	0.38
primer → CapableOf → amplify band	0.38
primer → ReceivesAction → used in the assay	0.38
primer → AtLocation → exon	0.38
primer → ReceivesAction → listed in table s4	0.38
primer → ReceivesAction → used on wood	0.38
primer → ReceivesAction → used in the pcr reactions	0.38
primer → CapableOf → prevent stain	0.38
primer → HasProperty → perfect	0.38
primer → ReceivesAction → designed using the software	0.37
primer → CapableOf → amplify gene	0.37
primer → HasProperty → short	0.37
primer → HasA → polymer	0.37
primer → ReceivesAction → sprayed	0.37
primer → CapableOf → amplify product	0.36
primer → ReceivesAction → complementary to hybridize	0.36
primer → HasProperty → polymorphic	0.36
primer → HasProperty → homologous	0.36
primer → CapableOf → use table s1	0.36
primer → CapableOf → stay in place	0.36
primer → HasProperty → heavy	0.36
primer → CapableOf → do the trick	0.36
primer → HasProperty → hard	0.35
primer → CapableOf → correspond to exon	0.35
primer → ReceivesAction → easy to apply	0.35
primer → HasA → spf	0.35
primer → HasProperty → free	0.35
primer → HasProperty → light	0.35
primer → CapableOf → smooth the skin	0.35
primer → HasProperty → fluid	0.35
silicone → AtLocation → primer	0.35
primer → CapableOf → come as spray	0.35
primer → HasA → restriction sites	0.35
primer → ReceivesAction → struck	0.35
primer → ReceivesAction → used in reaction	0.35
primer → HasProperty → key	0.35
primer → CapableOf → target region	0.35
primer → ReceivesAction → designed on the basis of sequences	0.35
primer → HasA → dimethicone	0.34
primer → CapableOf → fill in fine lines	0.34
primer → ReceivesAction → described in methods	0.34
primer → CapableOf → anneal to the template	0.34
primer → ReceivesAction → amplified	0.34
primer → ReceivesAction → excluded	0.34
primer → ReceivesAction → listed in s2 file	0.34
primer → CapableOf → prevent rust	0.34
primer → ReceivesAction → designed to match sequence	0.34
primer → CapableOf → serve as a starting point	0.34
primer → ReceivesAction → extended by dna polymerase	0.34
primer → CapableOf → ignite the powder charge	0.34
primer → HasProperty → cheaper	0.33
primer → HasProperty → effective	0.33
primer → HasProperty → pigmented	0.32
primer → CapableOf → span an exon-exon junction	0.32
primer → HasProperty → long	0.32
primer → CapableOf → flank the insertion site	0.32
primer → ReceivesAction → filled with talk of jihad	0.32
primer → CapableOf → use for rt-qpcr	0.32
primer → CapableOf → anneal to sequence	0.32
primer → ReceivesAction → used as template	0.32
primer → CapableOf → span region	0.32
primer → CapableOf → bind to the dna	0.32
primer → ReceivesAction → modified	0.32
primer → CapableOf → achieve tack-free condition	0.32
primer → ReceivesAction → written by daniel goleman	0.32
primer → ReceivesAction → written by richard boyatzis	0.32
primer → CapableOf → comprise pre-arranged handshake	0.32
primer → HasProperty → affordable	0.32
primer → CapableOf → prepare the skin	0.32
round → HasA → primer	0.32
primer → HasProperty → bad	0.32
primer → CapableOf → provide excellent base	0.31
primer → CapableOf → do good job	0.31
primer → CapableOf → target gene	0.31
primer → CapableOf → introduce an xbai site	0.31
primer → ReceivesAction → evaluated	0.31
primer → CapableOf → form film	0.31
primer → ReceivesAction → available in english	0.31
primer → CapableOf → serve as resource	0.31
primer → HasA → overlapping sequences	0.31
primer → ReceivesAction → applied to prepared substrate	0.31
primer → ReceivesAction → scrubbed	0.31
primer → CapableOf → eliminate the need	0.31
primer → ReceivesAction → indicated by arrow	0.31
primer → ReceivesAction → applied in thin, continuous film	0.31
primer → ReceivesAction → underlined	0.31
primer → CapableOf → anneal to region	0.31
primer → ReceivesAction → used to clean real lashes	0.31
primer → HasA → any sequence of nucleotides	0.31
primer → ReceivesAction → supplied with the kit	0.31
primer → ReceivesAction → allowed to dry at room temperature	0.31
primer → HasProperty → soluble	0.31
primer → HasProperty → silky	0.30
primer → CapableOf → look great	0.30
primer → HasProperty → nice	0.30
primer → ReceivesAction → packed with quiz	0.29
primer → CapableOf → come in powder	0.29
primer → HasA → the capability	0.29
primer → ReceivesAction → activated	0.29
primer → ReceivesAction → applied in thin wet coat	0.29
primer → CapableOf → flank the gene	0.29
primer → HasProperty → sensitive	0.29
primer → CapableOf → read into the biobrick plasmid	0.29
primer → ReceivesAction → marked	0.29
primer → ReceivesAction → designed to span intron	0.29
primer → ReceivesAction → fed like the powder	0.29
primer → ReceivesAction → screened	0.29
primer → ReceivesAction → trimmed	0.29
primer → ReceivesAction → downloaded	0.29
primer → ReceivesAction → separated	0.29
primer → CapableOf → create smooth surface	0.29
primer → CapableOf → flank the antibiotic insertion site	0.29
primer → ReceivesAction → regarded as absolute minimum anatomical knowledge	0.29
primer → CapableOf → anneal to the dna	0.29
primer → CapableOf → do their job	0.29
primer → ReceivesAction → applied to the skin	0.29
primer → CapableOf → make big difference	0.29
primer → CapableOf → reduce the appearance of fine lines	0.28
primer → ReceivesAction → applied before the adhesive	0.27
primer → HasProperty → careful	0.27
primer → CapableOf → adhere to the surface	0.27
primer → HasA → durable, finished surfaces	0.27
primer → CapableOf → bind to sequence	0.27
primer → HasProperty → blue tinted	0.27
primer → CapableOf → generate fragment	0.27
primer → ReceivesAction → distributed	0.27
primer → ReceivesAction → released	0.27
primer → CapableOf → anneal to site	0.27
primer → CapableOf → provide different perspectives	0.27
primer → ReceivesAction → bound to single-stranded nucleic acid	0.27
primer → HasProperty → elongated	0.27
primer → CapableOf → flank deleted region	0.27
primer → ReceivesAction → used on plaster	0.27
primer → ReceivesAction → applied before foundation	0.27
primer → ReceivesAction → applied to area	0.27
primer → CapableOf → fire on second bounce	0.27
primer → AtLocation → different exons	0.27
primer → ReceivesAction → matched	0.27
primer → ReceivesAction → biotinylated	0.27
primer → ReceivesAction → tested for amplification	0.27
primer → Causes → breakout	0.27
primer → HasProperty → universal	0.27
primer → CapableOf → anneal to verification primer binding sites	0.27
primer → CapableOf → anneal to each other	0.27
primer → ReceivesAction → synthesized by genewiz	0.27
primer → ReceivesAction → used in the project	0.27
primer → ReceivesAction → redesigned	0.27
primer → ReceivesAction → available in hindi	0.27
primer → HasA → ribonucleotide	0.27
primer → ReceivesAction → indented	0.27
primer → CapableOf → flank the insert	0.27
primer → CapableOf → use for real time	0.27
primer → UsedFor → cdna synthesis	0.27
primer → CapableOf → use for expression analysis	0.27
primer → CapableOf → sink into the skin	0.27
primer → CapableOf → create perfect canvas	0.27
primer → CapableOf → bind to the template	0.26
primer → CapableOf → act as sealant	0.25
primer → HasProperty → self-contained	0.25
primer → ReceivesAction → applied to both	0.25
primer → HasProperty → compliant	0.25
primer → CapableOf → start with example	0.25
primer → CapableOf → use contemporary political movement	0.25
primer → ReceivesAction → designed in the laboratory	0.25
primer → CapableOf → come in formula	0.25
primer → ReceivesAction → bought at any home improvement	0.25
primer → ReceivesAction → bought at paint shop	0.25
primer → ReceivesAction → designed by the author	0.25
primer → ReceivesAction → applied with cloth	0.25
primer → CapableOf → act as adhesive	0.25
primer → ReceivesAction → applied to concrete	0.25
primer → CapableOf → cover entire face	0.25
primer → CapableOf → help prevent mold	0.25
primer → CapableOf → use paintbrush	0.25
primer → CapableOf → help the paint bond	0.25
primer → CapableOf → flank the intron	0.25
primer → CapableOf → target sequence	0.25
primer → CapableOf → discuss the archtype	0.25
primer → UsedFor → sizes of pcr products	0.25
primer → CapableOf → introduce emotional intelligence	0.25
primer → CapableOf → use for mutagenesis	0.25
primer → HasA → jojoba oil	0.25
primer → ReceivesAction → designed to assist the judiciary	0.25
primer → ReceivesAction → pressed into crack	0.25
primer → ReceivesAction → pressed into pitting	0.25
primer → ReceivesAction → designed for quantification	0.25
primer → CapableOf → discuss the significance of the issues	0.25
primer → CapableOf → address issue	0.25
primer → CapableOf → fill crevice	0.25
primer → ReceivesAction → shown in 5'-3orientation	0.25
primer → CapableOf → cover natural coagulants	0.25
primer → ReceivesAction → used in second round	0.25
primer → CapableOf → use for confirmation	0.25
primer → CapableOf → target enriched exon fragments	0.25
primer → ReceivesAction → single-stranded	0.25
primer → ReceivesAction → listed in methods	0.25
primer → ReceivesAction → shown in desk	0.25
primer → CapableOf → support the discussions of the panel	0.25
primer → HasProperty → close	0.25
primer → ReceivesAction → applied to etched enamel	0.25
primer → CapableOf → detect gene	0.25
primer → CapableOf → fill in wrinkle	0.25
primer → CapableOf → form bond	0.25
primer → AtLocation → the 3'utr	0.25
primer → HasA → chalky feel	0.25
primer → UsedFor → normalization	0.25
primer → CapableOf → give basic	0.25
primer → ReceivesAction → labelled with hex	0.25
primer → UsedFor → the amplification reaction	0.25
primer → CapableOf → target just one place	0.25
primer → CapableOf → come in tube	0.25
primer → CapableOf → control absorbency	0.25
primer → ReceivesAction → based on snp locations	0.25
primer → ReceivesAction → shown in datasets7	0.25
primer → HasA → same base	0.25
primer → ReceivesAction → used to clone	0.25
primer → CapableOf → detect expression	0.25
primer → CapableOf → incorporate 50 bp of homology	0.25
primer → CapableOf → use genomic dna	0.25
primer → HasA → an ecori site	0.25
primer → ReceivesAction → designed for student	0.25
primer → HasProperty → complex	0.25
primer → CapableOf → consist of the restriction site sequences	0.25
primer → HasA → downstream flanking region	0.25
primer → ReceivesAction → designed in silico	0.25
primer → ReceivesAction → formulated with hyaluronic acid	0.25
primer → CapableOf → bind to their complementary sequences	0.25
primer → ReceivesAction → formulated with antioxidant	0.25
primer → ReceivesAction → designed using the catalogue of regulatory elements	0.25
primer → CapableOf → use for quantitative pcr	0.25
primer → HasProperty → hotter	0.25
primer → ReceivesAction → used on drywall	0.25
primer → CapableOf → serve same purpose	0.25
primer → CapableOf → use for nested pcr	0.25
primer → ReceivesAction → directed at the 16s rrna forward: cggcaggcctaacacatgcaagtcg	0.25
primer → HasSubevent → breakout	0.25
primer → HasA → deoxyribonucleotide	0.25
primer → HasA → a gc clamp	0.25
primer → CapableOf → form sealed propellant chamber	0.25
primer → CapableOf → amplify 18s	0.25
primer → HasProperty → red	0.25
primer → CapableOf → becomes hybridized	0.25
primer → ReceivesAction → intended to help policy-makers	0.25
primer → ReceivesAction → intended to help decision-makers	0.25
primer → ReceivesAction → dried in oven	0.25
primer → CapableOf → use a purification column	0.25
primer → CapableOf → span two exons	0.25
primer → ReceivesAction → shared with all event participants	0.25
primer → HasA → 40-60% gc content	0.25
primer → HasA → non-homologous 3ends	0.25
primer → ReceivesAction → substituted	0.25
primer → CapableOf → generate transcript	0.25
primer → CapableOf → anneal to cdna	0.25
ink → HasPrerequisite → primer	0.25
primer → CapableOf → provide excellent adhesion	0.25
primer → HasProperty → versatile	0.25
primer → ReceivesAction → worn	0.25
primer → HasProperty → fine	0.24
primer → CapableOf → create smooth canvas	0.24
primer → CapableOf → add radiance	0.24
primer → CapableOf → brighten the skin	0.24
primer → HasProperty → toxic	0.24
primer → CapableOf → blur imperfection	0.22
primer → HasProperty → stable	0.22
primer → CapableOf → be a waste of money	0.22
primer → HasA → salicylic acid	0.22
primer → HasA → mineral	0.21
primer → HasProperty → expensive	0.19
primer → CapableOf → penetrate the surface of the pipe	0.19
primer → CapableOf → penetrate the fitting	0.19
primer → ReceivesAction → rejected	0.19
primer → HasProperty → fun	0.19
primer → CapableOf → sound amazing	0.19
primer → HasProperty → corrosive	0.19
primer → HasProperty → colorless	0.19
primer → HasA → vitamin e	0.19
primer → HasProperty → new	0.19
primer → ReceivesAction → dented	0.19
primer → CapableOf → provide good surface	0.19
primer → CapableOf → ensure better adhesion of paint	0.19
primer → CapableOf → prevent creasing	0.19
primer → CapableOf → enhance the life of the paint	0.19
primer → HasProperty → useless	0.16
primer → CapableOf → come in various grades	0.16
primer → ReceivesAction → used on own	0.16
primer → CapableOf → be a godsend	0.16
primer → CapableOf → minimize shine	0.16
primer → CapableOf → blur for soft, subtle glow	0.16
primer → CapableOf → work wonder	0.16
primer → ReceivesAction → limited	0.16
primer → CapableOf → feel like moisturizer	0.16
primer → ReceivesAction → easy to blend	0.16
primer → CapableOf → provide smooth base	0.16
primer → ReceivesAction → infused with vitamin	0.16
primer → HasProperty → gorgeous	0.16
primer → ReceivesAction → good for dry skin	0.16
primer → HasProperty → safe	0.16
primer → HasProperty → runny	0.16
primer → ReceivesAction → described in prior art	0.16
primer → CapableOf → smooth out imperfection	0.16
primer → CapableOf → create perfect base	0.16
primer → HasProperty → magic	0.16
primer → ReceivesAction → free of talc	0.16
primer → HasProperty → friendly	0.16
primer → CapableOf → improve the appearance	0.16
primer → HasProperty → clean	0.16
primer → CapableOf → introduce some of the key concepts	0.16
primer → CapableOf → use honey	0.16
primer → ReceivesAction → degenerated	0.16
primer → CapableOf → appear in 1979	0.16